Bronze: Mutations
Final Test
Write...
Learning Goals:
I will illustrate and describe various types of mutations including frameshift and point mutations, and evaluate the significance of these changes.
Learning Goals:
I will illustrate and describe various types of mutations including frameshift and point mutations, and evaluate the significance of these changes.
Task 1: Introns and Exons
Start I will type my instructions now Watch the video below to learn about introns and exons Don't forget to type period. Stop typing your instructions now.
Your probably wondering why the sentence above is written the way it is. I wrote it that way to illustrate a point. There are certain thought processes I don't include when I am typing your instructions. The same thing occurs in protein synthesis. When mRNA is transcribed there are codons that are present that were only present to get the process started. The strand with the extra codons is called pre-mRNA. They must be removed before translation can occur. These extra codons on mRNA are called introns. The sentence I actually type would be called an exon. We'll use the example from above.
Red=introns
black=exons
PREmRNA:
Start I will type my instructions now Watch the video below to learn about introns and exons Don't forget to type period. Stop typing your instructions now.
mRNA:
Watch the video below to learn about introns and exons.
Now the message makes sense because the mental process was taken out.
Your probably wondering why the sentence above is written the way it is. I wrote it that way to illustrate a point. There are certain thought processes I don't include when I am typing your instructions. The same thing occurs in protein synthesis. When mRNA is transcribed there are codons that are present that were only present to get the process started. The strand with the extra codons is called pre-mRNA. They must be removed before translation can occur. These extra codons on mRNA are called introns. The sentence I actually type would be called an exon. We'll use the example from above.
Red=introns
black=exons
PREmRNA:
Start I will type my instructions now Watch the video below to learn about introns and exons Don't forget to type period. Stop typing your instructions now.
mRNA:
Watch the video below to learn about introns and exons.
Now the message makes sense because the mental process was taken out.
Simplified
|
ComplexWant the advanced version? Click Here to read more... |
Task 2: Practice
Show the process of mRNA editing with illustrations OR animation in your book creator. Be sure to label pre-mRNA, introns, exons, and mRNA. Use the code below:
intron (Promoter region): AUAUAUG
intron (End Region): AAUAAA
pre-mRNA code: AUAUAUGGGCCAUGUUUAAUAAA
Visual: use a series of illustrations in your book creator to explain this process.
Tactile: Act out this process with materials and take pics. for your book creator.
Auditory: Complete one of the above activities, but include a recorded explanation instead of a written one.
TURN IN on Edmodo
intron (Promoter region): AUAUAUG
intron (End Region): AAUAAA
pre-mRNA code: AUAUAUGGGCCAUGUUUAAUAAA
Visual: use a series of illustrations in your book creator to explain this process.
Tactile: Act out this process with materials and take pics. for your book creator.
Auditory: Complete one of the above activities, but include a recorded explanation instead of a written one.
TURN IN on Edmodo
Task 3: Types of Mutations
Did you make any mistakes when you were editing your mRNA code? If so this would be a type of mutation that can actually occur.
There are several types of mutations: Substitution, Insertion, Deletion, and Frame-shift
Mutations can occur when DNA is being copied during S-phase of the cell-cycle. Mutations can also occur during the editing of pre-mRNA.
Causes of Mutations
Mutations can be caused by problems during DNA replication, by radiation, by chemicals, and by problems during Meiosis (which we will talk about later).
For now we are focusing on somatic mutations. The term somatic refers to cells that undergo mitosis, so all cells accept sex cells.
Watch the video below and complete this hand-out found at Table 6 over types of mutations.
OR
Read this and complete the above hand-out.
There are several types of mutations: Substitution, Insertion, Deletion, and Frame-shift
Mutations can occur when DNA is being copied during S-phase of the cell-cycle. Mutations can also occur during the editing of pre-mRNA.
Causes of Mutations
Mutations can be caused by problems during DNA replication, by radiation, by chemicals, and by problems during Meiosis (which we will talk about later).
For now we are focusing on somatic mutations. The term somatic refers to cells that undergo mitosis, so all cells accept sex cells.
Watch the video below and complete this hand-out found at Table 6 over types of mutations.
OR
Read this and complete the above hand-out.
Task 4: Practice
Complete this assignment. Turn in on Edmodo
Task 5: Create your own mutations
Create your own code 12 nucleotides long. Demonstrate the following types of nucleotide mutations: Substitution, Insertion, Deletion, and Frame-shift
Demonstrate the following types of chromosomal mutations: deletion, translocation, inversion, duplication
Be sure to use different colors to help show the above mutations.
Visual: Illustrate these in your book creator.
Tactile: Demonstrate this with the nucleotide cards at table 5. Take pictures for your book creator. Include labels and explanation either verbal or written.
Auditory: Choose one of the above activities, but include a recorded explanation in your book creator.
TURN IN on Edmodo
Demonstrate the following types of chromosomal mutations: deletion, translocation, inversion, duplication
Be sure to use different colors to help show the above mutations.
Visual: Illustrate these in your book creator.
Tactile: Demonstrate this with the nucleotide cards at table 5. Take pictures for your book creator. Include labels and explanation either verbal or written.
Auditory: Choose one of the above activities, but include a recorded explanation in your book creator.
TURN IN on Edmodo